NIID NOTCH2NLC

Neuronal intranuclear inclusion disease, Alzheimer disease and parkinsonism phenotype, Oculopharyngodistal myopathy (OPDM) type 3, hereditary essential tremor type 6

Inheritance

Autosomal dominant

Description

Neuronal intranuclear inclusion disease (NIID) is a very rare multisystem neurodegenerative disorder characterized by the presence of eosinophilic intranuclear inclusions in neuronal and glial cells, and neuronal loss¹. Often presents with gastrointestinal symptoms, including chronic refractory nausea, which can precede neurologic manifestations by decades in one documented case [pmid:41929501]. Renal, bladder, and other visceral organ involvement have been reported and may occasionally precede neurological symptoms^2,3. Subclinical peripheral neuropathy has been reported in NOTCH2NLC related NIID. Due to overlapping phenotypes and the shared locus, it is unclear whether these four diseases are comorbid, synonymous, or entirely separate.

Prevalence

>400 patients reported in literature⁴. Found in individuals of East Asian ancestry⁵.

Age of Onset Details

Typical: 30-70⁶; Range: 10⁷- 78⁸.

Locus

hg19

chr1:145209323-145209354

hg38

chr1:149390802-149390842

t2t

chr1:148519695-148519738

Details

Benign alleles are less than 38 repeats, while pathogenic alleles contain 66+ repeats⁹. Intermediate alleles may be associated with a phenotypic spectrum, and even pathogenic cases can have variable phenotype^10,11: NOTCH2NLC expansions have been linked Alzheimer's disease and Parkinson's disease, leading to a potential role in NIID-related disorders¹². Age of onset inversely related to allele size¹³. Motif variation in controls: (AGG)(CGG)n(AGG)0-3(CGG)0-2. GGA and AGC interruptions may influence phenotype¹⁴. Interruptions documented: GGA, GGG¹⁵; ACCGAGAAGATGCCCGCCCTGC interruption proposed but not confirmed¹⁶. Detection may be challenging due to parology between genes: C253572.1, NOTCH2, NOTCH2NL, NBPF14, NBPF19. Short read sequencing is unreliable for definitive sizing of large or complex expansions. RP-PCR can screen for expansions⁴, but long-read sequencing best resolves size, structure, and methylation¹⁷.

Mechanism

GoF

Polyglycine expansion; may relate to methylation or RNA pathogenicity^6,18,16. Proposed mechanisms include toxic uN2CpolyG/polyglycine aggregation, RNA pathogenicity, impaired autophagy, mitochondrial dysfunction, and innate immune activation². The polyglycine-containing protein sequesters a key subunit of transcription factor NF-κB in nuclear inclusions, leading to impaired autophagy¹⁹. Tau pathology is evident, changes in p-tau levels and tau deposition have been reported²⁰. Expanded polyG proteins also induce nucleolar stress through interaction with NPM1 and rRNA. This disrupts ribosomal homeostasis and alters 3D chromatin organization through reduced CTCF/RAD21 expression²¹.

Year

2019²²

Location in Gene

5' UTR

Gene Strand

Alleles

Ref. Motif

GGC

Pathogenic (ref.)

GGC

Pathogenic (gene)

CGG

Interruption (ref.)

GGA, AGC

Interruption (gene)

AGG, AGC

gnomAD

Pathogenic genotype frequency data is not displayed for this locus because a substantial number of large alleles failed manual review by the gnomAD team.

References

Direct supporting references for info on this page.

Ontology Lookup Service (OLS)

mondo:0011327

Heterogenous Genetic, Clinical, and Imaging Features in Patients with Neuronal Intranuclear Inclusion Disease Carrying

Yusran Ady,Fitrah, Yo,Higuchi, Norikazu,Hara, Takayoshi,Tokutake, Masato,Kanazawa, Kazuhiro,Sanpei, Tomone,Taneda, Akihiko,Nakajima, Shin,Koide, Shintaro,Tsuboguchi, Midori,Watanabe, Junki,Fukumoto, Shoichiro,Ando, Tomoe,Sato, Yohei,Iwafuchi, Aki,Sato, Hideki,Hayashi, Takanobu,Ishiguro, Hayato,Takeda, Toshiaki,Takahashi, Nobuyoshi,Fukuhara, Kensaku,Kasuga, Akinori,Miyashita, Osamu,Onodera, Takeshi,Ikeuchi

Brain sciences · 2023-06-15

pmid:37371433

Neurological disorders caused by novel non-coding repeat expansions: clinical features and differential diagnosis.

Elisa,Vegezzi, Hiroyuki,Ishiura, D Cristopher,Bragg, David,Pellerin, Francesca,Magrinelli, Riccardo,Currò, Stefano,Facchini, Arianna,Tucci, John,Hardy, Nutan,Sharma, Matt C,Danzi, Stephan,Zuchner, Bernard,Brais, Mary M,Reilly, Shoji,Tsuji, Henry,Houlden, Andrea,Cortese

The Lancet. Neurology · 2024-07-01

pmid:38876750

omim:603472

Clinical Features and Classification of Neuronal Intranuclear Inclusion Disease.

Hongfei,Tai, An,Wang, Yumei,Zhang, Shaocheng,Liu, Yunzhu,Pan, Kai,Li, Guixian,Zhao, Mengwen,Wang, Guode,Wu, Songtao,Niu, Hua,Pan, Bin,Chen, Wei,Li, Xingao,Wang, Gehong,Dong, Wei,Li, Ying,Zhang, Sheng,Guo, Xiaoyun,Liu, Mingxia,Li, Hui,Liang, Ming,Huang, Wei'an,Chen, Zaiqiang,Zhang

Neurology. Genetics · 2023-02-28

pmid:37090934

Rapidly progressive adult-onset neuronal intranuclear inclusion disease beginning with autonomic symptoms: a case report.

Yi,Zhu, Qian,Yang, Yun,Tian, Weibing,Fan, Xinfa,Mao

Frontiers in neurology · 2023-05-25

pmid:37305750

Resources for Genetics Professionals — Genetic Disorders Caused by Nucleotide Repeat Expansions and Contractions

Stephanie E.,Wallace, Lora JH,Bean

GeneReviews® [Internet] · 2022-10-20

genereviews:NBK535148

Erratum: Prevalence and Characterization of

Neurology. Genetics · 2024-07-12

pmid:39055960

Familial adult-onset neuronal intranuclear inclusion disease: A case report and literature review.

Lijun,Wei, Jiaqi,Wang, Changming,Xu, Tengchao,Yang, Yun,Tian, Lu,Shen

Medicine · 2024-11-01

pmid:39496005

Expansion of Human-Specific GGC Repeat in Neuronal Intranuclear Inclusion Disease-Related Disorders.

Yun,Tian, Jun-Ling,Wang, Wen,Huang, Sheng,Zeng, Bin,Jiao, Zhen,Liu, Zhao,Chen, Yujing,Li, Ying,Wang, Hao-Xuan,Min, Xue-Jing,Wang, Yong,You, Ru-Xu,Zhang, Xiao-Yu,Chen, Fang,Yi, Ya-Fang,Zhou, Hong-Yu,Long, Chao-Jun,Zhou, Xuan,Hou, Jun-Pu,Wang, Bin,Xie, Fan,Liang, Zhuan-Yi,Yang, Qi-Ying,Sun, Emily G,Allen, Andrew Mark,Shafik, Ha Eun,Kong, Ji-Feng,Guo, Xin-Xiang,Yan, Zheng-Mao,Hu, Kun,Xia, Hong,Jiang, Hong-Wei,Xu, Ran-Hui,Duan, Peng,Jin, Bei-Sha,Tang, Lu,Shen

American journal of human genetics · 2019-06-06

pmid:31178126

Neuronal Intranuclear Inclusion Disease with NOTCH2NLC GGC Repeat Expansion: A Systematic Review and Challenges of Phenotypic Characterization.

Tian,Zeng, Yiqun,Chen, Honghao,Huang, Shengqi,Li, Jiaqi,Huang, Haobo,Xie, Shenyi,Lin, Siyao,Chen, Guangyong,Chen, Dehao,Yang

Aging and disease · 2024-01-31

pmid:38377026

The Phenotypes and Mechanisms of NOTCH2NLC-Related GGC Repeat Expansion Disorders: a Comprehensive Review.

Xiu-Rong,Huang, Bei-Sha,Tang, Peng,Jin, Ji-Feng,Guo

Molecular neurobiology · 2021-10-31

pmid:34718964

Comprehensive genetic diagnosis of tandem repeat expansion disorders with programmable targeted nanopore sequencing.

Igor,Stevanovski, Sanjog R,Chintalaphani, Hasindu,Gamaarachchi, James M,Ferguson, Sandy S,Pineda, Carolin K,Scriba, Michel,Tchan, Victor,Fung, Karl,Ng, Andrea,Cortese, Henry,Houlden, Carol,Dobson-Stone, Lauren,Fitzpatrick, Glenda,Halliday, Gianina,Ravenscroft, Mark R,Davis, Nigel G,Laing, Avi,Fellner, Marina,Kennerson, Kishore R,Kumar, Ira W,Deveson

Science advances · 2022-03-04

pmid:35245110

Sequence composition changes in short tandem repeats: heterogeneity, detection, mechanisms and clinical implications.

Indhu-Shree,Rajan-Babu, Egor,Dolzhenko, Michael A,Eberle, Jan M,Friedman

Nature reviews. Genetics · 2024-03-11

pmid:38467784

Clinical and neuroimaging review of triplet repeat diseases.

Ryo,Kurokawa, Mariko,Kurokawa, Akihiko,Mitsutake, Moto,Nakaya, Akira,Baba, Yasuhiro,Nakata, Toshio,Moritani, Osamu,Abe

Japanese journal of radiology · 2022-09-28

pmid:36169768

uN2CpolyG-mediated p65 nuclear sequestration suppresses the NF-κB-NLRP3 pathway in neuronal intranuclear inclusion disease.

Yu,Shen, Kaiyan,Jiang, Dandan,Tan, Min,Zhu, Yusen,Qiu, Pencheng,Huang, Wenquan,Zou, Jianwen,Deng, Zhaoxia,Wang, Ying,Xiong, Daojun,Hong

Cell communication and signaling : CCS · 2025-02-07

pmid:39920690

Plasma p-tau species are elevated in presymptomatic and symptomatic neuronal intranuclear inclusion disease.

Sizhe,Zhang, Bin,Jiao, Yan,Zeng, Qiying,Sun, Xiaoyu,Chen, Weiwei,Zhang, Ziyu,Ouyang, Qiao,Xiao, Lu,Zhou, Yunni,Li, Ling,Weng, Juan,Du, Qian,Xu, Yang,Yang, Mengqi,Zhang, Qiuming,Zeng, Liangjuan,Fang, Hongyu,Long, Yuanyuan,Xie, Si,Chen, Li,Feng, Qing,Huang, Lili,Long, Yafang,Zhou, Fang,Yi, Yacen,Hu, Qiong,Liu, Yongcheng,Pan, Lin,Zhou, Yulai,Li, Shuo,Hu, Jifeng,Guo, Junling,Wang, Hong,Jiang, Hongwei,Xu, Ranhui,Duan, Beisha,Tang, Yun,Tian, Lu,Shen

EBioMedicine · 2026-01-14

pmid:41539185

Noncoding CGG repeat expansions in neuronal intranuclear inclusion disease, oculopharyngodistal myopathy and an overlapping disease.

Hiroyuki,Ishiura, Shota,Shibata, Jun,Yoshimura, Yuta,Suzuki, Wei,Qu, Koichiro,Doi, M Asem,Almansour, Junko Kanda,Kikuchi, Makiko,Taira, Jun,Mitsui, Yuji,Takahashi, Yaeko,Ichikawa, Tatsuo,Mano, Atsushi,Iwata, Yasuo,Harigaya, Miho Kawabe,Matsukawa, Takashi,Matsukawa, Masaki,Tanaka, Yuichiro,Shirota, Ryo,Ohtomo, Hisatomo,Kowa, Hidetoshi,Date, Aki,Mitsue, Hiroyuki,Hatsuta, Satoru,Morimoto, Shigeo,Murayama, Yasushi,Shiio, Yuko,Saito, Akihiko,Mitsutake, Mizuho,Kawai, Takuya,Sasaki, Yusuke,Sugiyama, Masashi,Hamada, Gaku,Ohtomo, Yasuo,Terao, Yoshihiko,Nakazato, Akitoshi,Takeda, Yoshio,Sakiyama, Yumi,Umeda-Kameyama, Jun,Shinmi, Katsuhisa,Ogata, Yutaka,Kohno, Shen-Yang,Lim, Ai Huey,Tan, Jun,Shimizu, Jun,Goto, Ichizo,Nishino, Tatsushi,Toda, Shinichi,Morishita, Shoji,Tsuji

Nature genetics · 2019-07-22

pmid:31332380

Additional Literature

Additional literature related to this locus.

Raw PubMed search results
(All PubMed results returned by searching for this gene, tandem repeats, and disease, in medline format)

Immunological characterization of neuronal intranuclear inclusion disease with kidney injury: an exploratory analysis in a multi-center cohort.

Ying,Ji, Xiaowen,Li, Jin,Tian, Xian,Chen, Guang,Ji, Maofeng,Shi, Jing,Zhang, Man,Xia, Qianru,An, Xiang,Li, Liangyu,Li, Wenjing,Song, Ruixue,Zhang, Lei,Bao, Yuqiao,Wang, Yingying,Cui, Yuyao,Tian, Hao,Chen

Frontiers in immunology · 2026-04-14

pmid:42058219

Adult-Onset Neuronal Intranuclear Inclusion Disease Initially Manifesting as Bladder Dysfunction: A Case Report.

Anna,Yamaki, Hirofumi,Sekino, Satoshi,Kawana, Ryo,Yamakuni, Shiro,Ishii, Hiroshi,Ito

Cureus · 2026-03-19

pmid:42005169

Father-to-offspring transmission of extremely long NOTCH2NLC repeat expansions with contractions: genetic and epigenetic profiling with long-read sequencing.

Hiromi,Fukuda, Daisuke,Yamaguchi, Kristofor,Nyquist, Yasushi,Yabuki, Satoko,Miyatake, Yuri,Uchiyama, Kohei,Hamanaka, Ken,Saida, Eriko,Koshimizu, Naomi,Tsuchida, Atsushi,Fujita, Satomi,Mitsuhashi, Kazuyuki,Ohbo, Yuki,Satake, Jun,Sone, Hiroshi,Doi, Keisuke,Morihara, Tomoko,Okamoto, Yuji,Takahashi, Aaron M,Wenger, Norifumi,Shioda, Fumiaki,Tanaka, Naomichi,Matsumoto, Takeshi,Mizuguchi

Clinical epigenetics · 2021-11-13

pmid:34774111

uN2CpolyG-mediated p65 nuclear sequestration suppresses the NF-κB-NLRP3 pathway in neuronal intranuclear inclusion disease.

Yu,Shen, Kaiyan,Jiang, Dandan,Tan, Min,Zhu, Yusen,Qiu, Pencheng,Huang, Wenquan,Zou, Jianwen,Deng, Zhaoxia,Wang, Ying,Xiong, Daojun,Hong

Cell communication and signaling : CCS · 2025-02-07

pmid:39920690

ASO therapy rescues NOTCH2NLC GGC repeat expansion-induced genomic damage, 3D chromatin structural abnormalities, and senescence.

Mengjie,Li, Mibo,Tang, Xiaoyan,Hao, Zhengwei,Hu, Dongrui,Ma, Shuangjie,Li, Chunyan,Zuo, Zhiyun,Wang, Yuanyuan,Liang, Yanmei,Feng, Chenwei,Hao, Chen,Wang, Huanyu,Li, Yalan,Yang, Yuemeng,Sun, Shasha,Qi, Chengyuan,Mao, Yuming,Xu, Qun,Wang, De,Yang, Ruwei,Yang, Ziyao,Zhou, Peilin,Ji, Song,Tan, Zaiqiang,Zhang, Hao,Chen, Albert R,La Spada, Changhe,Shi

Nature communications · 2026-04-07

pmid:41942455

Unilateral Cortical Ribboning and Corticomedullary Lesions in a Rare Case of Coexisting Anti-N-methyl-D-aspartate Receptor Encephalitis and Neuronal Intranuclear Inclusion Disease.

Chen-Chang,Shih, Kuo-Hsuan,Chang

Acta neurologica Taiwanica · 2026-04-24

pmid:42033810

A Case of Neuronal Intranuclear Inclusion Disease Mimicking Acute Stroke.

Junki,Yoshimura, Toshiyuki,Hayashi, Yu,Kashimoto, Yuki,Sakamoto, Kentaro,Suzuki, Chisato,Tamai, Jun,Sone, Satoshi,Suda

Internal medicine (Tokyo, Japan) · 2026-04-21

pmid:42021030

Overflow urinary incontinence as an early manifestation of neuronal intranuclear inclusion disease (NIID): a case report.

Ming,Yang, Zhaoping,Wu, Guoyuan,Ju, Tingting,Duan

Journal of medical case reports · 2026-04-21

pmid:42015293

Recurrent Bilateral Macular Edema Linked to NOTCH2NLC GGC Repeat Expansion: A Case Report.